![]() |
Hosted @RenLab |
|
|
Protocols used in ChIP-on-chip experimentsBlunting, ligation of linkers to DNA, and amplification by PCR: The immunoprecipitated DNA is typically present in very small quantities (1-10 ng total), and it is therefore necessary to perform an amplification step prior to labeling and DNA microarray analysis. To achieve this, a ligation-mediated PCR (LM-PCR) p rocedure is used. Because the DNA at this stage contains recessed and heterogeneous ends as a result of the physical shearing process, it is first treated with T4 DNA polymerase to form blunt ends. Then a linker is ligated to the DNA fragments. The ad dition of this linker allows the DNA to be amplified by PCR using a universal oligonucleotide primer. Blunting, ligation, and PCR In an Eppendorf tube, the immunoprecipitated DNA (or 20 ng of control input DNA) is combined with 11 µl of 10X T4 DNA polymerase buffer (New England Biolabs), 0.5 µl BSA (10 mg/ml) (New England Biolabs), 0. 5 µl dNTP mix (20 mM each), 0.2 µl T4 DNA polymerase (3U/µl) (New England Biolabs), and distilled H2O in a total volume of 112.2 µl. After a 20 minute incubation at 12°C, 1/10 volume of 3M sodium acetate (pH 5.2) and 20µg of glycogen (Roche Applied Sciences) are added to the tube, and the DNA sample is extracted once with phenol:chloroform:isoamyl alcohol (25:24:1)(Sigma). After ethanol precipitation, the DNA is dissolved in 25 µl of distilled H2< /sub>O. The blunt-ended DNA is mixed with 8 µl of distilled H2O, 10 µl of 5X ligase buffer (Invitrogen), 6.7 µl of annealed oligonucleotide linkers (oligo-1: GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC, anneale d to make a 15mM solution), and 0.5 µl T4 DNA ligase (New England Biolabs) for a total volume of 50 µl. The ligation reaction is allowed to proceed overnight at 16°C. After ligation, the DNA is purified by ethanol precipitation and dissolved in 25 µl of distilled H2O. The ligated DNA is then mixed with 4 µl of 10X ThermoPol reaction buffer (New England Biolabs), 4.75 µl distilled H2O, 5 µl of 10X dNTP mix (2.5 mM each), 1.25 µl oligo-1 (40 µM stock) in a final volume of 40 µl in a 200 µl thin-walled PCR tube. The tube is first incubated at 55°C for 2 minutes in a thermal cycler to separate linker oligonucleotides not ligated to the DNA, then 10 µl of an enzyme mix [8µl dH2O, 1 µl Taq DNA polymeras e (5U/µl), 1 µl ThermoPol reaction buffer, and 0.025 unit of Pfu polymerase (Stratagene)] is added. Subsequently, the following PCR protocol is performed:
After PCR, the DNA is purified using the Qiaquick PCR purification kit (Qiagen) and eluted in 50 µl elution buffer provided with the kit. |